90
|
Addgene inc
mammalian expression vectors phace Mammalian Expression Vectors Phace, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mammalian expression vectors phace/product/Addgene inc Average 90 stars, based on 1 article reviews
mammalian expression vectors phace - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
91
|
Addgene inc
phace expression vectors Phace Expression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phace expression vectors/product/Addgene inc Average 91 stars, based on 1 article reviews
phace expression vectors - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
90
|
BioAsia Group
primer pair ii: tgcgagctcatgcgagacaagtcgaacccg catggatcctcagcggatatgcacgtaggtgcc Primer Pair Ii: Tgcgagctcatgcgagacaagtcgaacccg Catggatcctcagcggatatgcacgtaggtgcc, supplied by BioAsia Group, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer pair ii: tgcgagctcatgcgagacaagtcgaacccg catggatcctcagcggatatgcacgtaggtgcc/product/BioAsia Group Average 90 stars, based on 1 article reviews
primer pair ii: tgcgagctcatgcgagacaagtcgaacccg catggatcctcagcggatatgcacgtaggtgcc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |